Cancer System. Expression was normalized to the expression

Cancer cells were treated in the same way as for the caspase-3 activity analysis,
and lysed in 50 µl of RIPA buffer (Sigma-Aldrich, St-Quentin Fallavier, France)
containing freshly added protease and phosphatase inhibitors (Pierce
Biotechnology, Perbio Science, Rockford, USA). 40 µg of proteins were loaded for
each lane on 10 % SDS-PAGE gels and transferred to a nitrocellulose membrane. 5
% fat free milk in TBS with 0.1 % tween-20 (TBST) was used for bloking at room
temperature for 1 h, then, membranes were incubated with anti-phospho-Erk1/2 (Cell
signaling) and with GAPDH antibody for loading control
(Cell signaling, Ozyme, Yvelines, France) overnight at 4°C.  After three times washing with TBST, primary
antibodies were detected with the Odyssey system (Li-cor Biosciences) using goat
anti-mouse IgG (H+L) cross-adsorbed secondary Antibody, Alexa Fluor® 700
conjugate (Thermo Fisher Scientific).

Western Blotting

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

 

Total RNA was extracted from breast cancer cells using NucleoSpin® RNA
XS-column (Macherey-Nagel, Düren, Germany) according
to the manufacturer’s instructions. 1 ?g of RNA reverse-transcribed into cDNA
using iScript cDNA synthesis kit (Bio-Rad). qPCR amplification was done using
iQ™ SYBR® Green supermix (Bio-Rad) method according to the
manufacturer’s instructions under the Roche LightCycler480 System. Expression
was normalized to the expression of human GAPDH. Primers designed to assess
gene expression are as follows (5′ to 3′): Stim1 forward
gcagagttttgccgaattg and reverse tgaggtgattatggcgagtc; Orai1 forward
gagttactccgaggtgatga and reverse gaccgagttgagattgtgc; Orai2 forward
catggattaccgggactg and reverse cacggggaggaacttgat; Orai3 forward
ttgctgaagttgtcctgg and reverse tcctctagttcctgcttgtag; Trpc1 forward
ctggtatgaagggttggaaga and reverse aaagcaggtgccaatgaac; Trpc3 forward
atgacagtgatgcgggaga and reverse cctcgtcgtaagcgtagaagt; Trpc4 forward
tggatgatattaccgtgggt and reverse cttcaaaatgtccaggagca; Trpc5 forward
ctccctctacctggcaactat and reverse gctcctacaaactcggtgaat; Trpc6 forward
tttactggtttgctccatgc and reverse agaggggtcccactttatcc; Trpc7 forward
cgacgacgacttctatgcct and reverse cgcccactacaaaatcctt; Gapdh forward
aacagcgacacccactcctc and reverse ggaggggagattcagtgtggt. 2-??CT referred to the fold-change of the RNA
expression of one sample when compared to the internal control sample.

RNA extraction and RT-qPCR

 

Cancer cells were treated with Bapta-AM (5 µM) or EGTA (100 µM) for 30
min then stimulated with simvastatin (100 nM) or doxorubicin (1 µM) for 24
hours. The measurement of cytochrome c release was evaluated using the
enzyme linked immunosorbent
assay (ELISA) kits (Abcam Biochemicals, France) according to manufacturer’s
instructions.

ELISA cytochrome c measurement

 

Tumor cells migration
was evaluated using in vitro wound-healing
assay. Wounds were created by scraping a 80% confluent cell monolayer with a
sterile pipette tip and
gently washed with PBS. Cells were maintained in RPMI containing 10% FBS with
BAPTA-AM (5 µM) or EGTA (100 µM) for 30 min then stimulated with or without
simvastatin (100 nM) or doxorubicin (1 µM). Images of wounds were taken
immediately and 6 h after wounding (no proliferation was observed). Wound areas
were measured in five random fields by Saisam software (Microvision
Instruments, Evry, France) and photographed by Axiovert 135 microscope (Zeiss,
Le Pecq, France) with a Sony DXC-930P video camera. Wound closure was
calculated as the percentage of wound area change after 6 h.

Cell
migration assay

 

Activity of caspase-3 was measured using Ac-DEVD-AFC substrate (Enzo
Life Sciences (ELS) AG, Villeurbanne, France), according to the manufacturer’s
instructions. Briefly, breast cancer cells were treated with BAPTA-AM (5 µM) or
EGTA (100 µM) for 30 min then stimulated with simvastatin (100 nM) or
doxorubicin (1 µM) for 24 hours, and then collected and lysed in cell lysis
buffer (HEPES 50 mM, NaCl 100 mM, DTT 10 mM, CHAPS 0.1%, EDTA 1 mM, pH 7.4). Equal
amounts of cell lysate (20 µg) were added to 100 ?L of caspase-3 buffer containing 40 ?M of the caspase-3 substrate Ac-DEVD-AFC (fluorogenic)
as final concentration and incubated at 37°C for 1 h in the dark. For breast
cancer cell xenografts, tissues were quickly excised and lysates were prepared
in Kontes tubes using the same buffer described above. Caspase-3 activity was
assessed by measuring fluorescence at excitation wavelength of 400 nm and
emission wavelength of 505 nm using SAFAS Xenius XC Spectrofluorometer (MC
98000 Monaco).

Measurement
of Caspase-3 Activity

 

Cancer cell lines
were treated with BAPTA-AM (5 µM) or EGTA (100 µM) for 30 min then stimulated
with simvastatin (100 nM) or doxorubicin (1 µM) for 24 hours. Cells were then
loaded with 20 µM of Dihydrorhodamine 123 (DHR 123, a fluorescent probe for the
detection of reactive oxygen species, Santa Cruz Biotechnology Inc.,
Heidelberg, Germany) for 30 min at 37°C. Cells were washed twice with PBS
buffer after dye loading and the fluorescence intensity of Rhodamine 123 was
measured with Spectrofluorometer SAFAS Xenius XC at Ex 500nm/Em536 and by
absorbance spectroscopy at 500 nm. Images were
acquired with Zeiss Axiovert 200M fluorescence microscope (Zeiss, Le Pecq,
France) using FITC channel.

Measurement of intracellular reactive oxygen species
(ROS)

 

Mitochondrial
membrane potential was measured using the cationic dye JC-10 (a fluorescent ??m
dye, Santa Cruz Inc., Germany). This dye is red in polarized mitochondria and
green in depolarized mitochondria. Breast cancer cells were incubated with
BAPTA-AM (5 µM) or EGTA (100 µM) for 30 min then stimulated with simvastatin
(100 nM) or doxorubicin (1 µM) for 24 hours  before loaded with 20 µM of JC-10 for 30 min
at 37°C. After washing, the fluorescence intensity for both J-aggregates and
monomeric forms of JC-10 was measured using SAFAS Xenius XC Spectrofluorometer
(MC 98000 Monaco) at Ex 485nm/Em520 and 595nm.

Measurement of mitochondrial membrane potential (??m)

 

Breast cancer cells were first incubated with BAPTA-AM (5 µM) or EGTA
(100 µM) for 30 min then stimulated with simvastatin (100 nM) or doxorubicin (1
µM) for 24 hours. Then, mitochondrial calcium (Ca2+m)
was measured by loading breast cancer cells with the cell permeable Ca2+-indicator
Rhod-2/AM (2 µM; dissolved in DMSO) in RPMI for 1 h at 37 °C, and then washed three
times in rhod-2-free medium. To determine Ca2+m, Rhod-2
was excited at ?ex (552 nm), and fluorescence was recorded at ?em (581 nm)
under SAFAS Xenius XC Spectrofluorometer

Mitochondrial Calcium measurement

 

Cancer cells were
treated with BAPTA-AM (5 µM) or EGTA (100 µM) in association or not with simvastatin
(100 nM) or doxorubicin (1 µM) for 48 hours and then washed with cold PBS and
fixed with cold 70% ethanol for 30min at room temperature. After washing with
PBS, cells were incubated in the dark for 15 min with 1 mg/ml RNase A, 1 mg/ml
propidium iodide in PBS. Cell-cycle distribution was determined by PI staining
using flow cytometry (BD Biosciences, USA) and analyzed by FlowJo 10.1.

Flow cytometry to examine cell cycle progression

 

Cancer cells were treated with simvastatin (100 nM) or doxorubicin (1
µM) in the presence or absence of BAPTA-AM (5 µM) or EGTA (100 µM) for 48 hours
and then apoptotic cells were determined by Annexin V-FITC/PI staining (Abcam
Biochemicals, France) according to the instruction. The percentage of annexin
V-FITC and propidium iodide-positive cells were assessed by flow cytometry
using BD FACSCanto II flow cytometer (BD Biosciences, USA). All flow cytometry
data were analyzed using FlowJo 10.1 for Macintosh (Ashland, OR, USA).

Apoptosis
assays

                                                

Phase contrast images were captured using an Axiovert 135 microscope
(Zeiss, Le Pecq, France) with a Sony 3-CCD color video camera (DXC-930P) and
the Saisam software (Microvision Instruments, Evry, France).

Phase
contrast imaging

 

HA hydrogels-containing cells were placed in a 96-well plate and colonies
were grown for 6 days. For
colony quantification, cell colonies were evaluated using MTT method as
described above and absorbance of released dye was measured at 540 nm using a
SAFAS Xenius XC microplate reader. The values of control treatment were
considered as 100%.

Cell colonies counting

 

In some experiments, HA Hydrogels were fixed at the end of invasion period
with 4 % paraformaldehyde (PFA) for 30 minutes. After three rinses in PBS,
cells were permeabilized for 5 min in PBS containing 0.5 % Triton X-100 and
stained with 1µg/ml DAPI (Sigma-Aldrich, St-Quentin Fallavier, France) for 1 h
30 at room temperature. After three washing with PBS, Cells invasiveness in HA
hydrogels were visualized and photographed under Zeiss Axiovert 200M
fluorescence microscope.

Cell colonies fixation and DAPI staining

 

The invasiveness of the human breast carcinoma cells in HA Hydrogels refers
to the ability of tumor cells to penetrate the HA matrix and form colonies. To
this end, cells were seeded in 12-well plates at 1 x 106 cells per
well with HA hydrogel in RPMI 1640 medium supplemented with 10 % FCS, 1 %
glutamine and 0.1 % antibiotics. Cells were allowed to penetrate the HA
hydrogels for 1 day (invasion period) in a humidified atmosphere under 5 % CO2
at 37 °C. Then the HA hydrogels were placed in new plates with fresh
medium for 5 days to allow the formation of colonies (colonies formation period).
The cells were treated with simvastatin (100 nM) or doxorubicin (1 µM) during
the HA hydrogel penetration period and the colonies formation period in the
presence or absence of extracellular Ca2+ chelator (EGTA, 100 µM) or
intracellular Ca2+ chelator (BAPTA-AM, 5 µM).

Cells invasiveness and colony formation in HA hydrogels

 

Hyaluronic acid (HA) hydrogels were synthesized at “Polymères, Biopolymères
Surfaces” laboratory (UMR 6270, University of Rouen, France). This process has
been described in two Europeans patents: “Improved Crosslinked Hyaluronan
Hydrogels for 3D culture” EP10305666. 9, June 22, 2010 and “Method for
Harvesting Cells Cultured in 3D Hydrogel Matrices” EP10305667.7, June 22, 2010.
Hydrogels were cut into 2 × 2 × 0.5 mm cubes, sterilized and then rehydrated in
RPMI 1640 medium with 0.1 % antibiotics.

Synthesis of HA hydrogels for 3D
culture

 

For cytoplasmic Ca2+ monitoring, cancer cells were cultured
on Krystal 24-well glass bottom (Proteigene, Saint-Marcel, France) coated with
poly-D-lysine and then incubated with Fura-2/AM (5 µM) diluted in culture
medium for 60 min at 37°C. After loading, the cells (5 x 104/ml)
were washed three times (600g x 10 min) and remained suspended in a calcium buffer
solution containing: 110 mM, NaCl; 5.4 mM, KCl; 25 mM, NaHCO3; 0.8
mM, MgCl2; 0.4 mM, KH2PO4; 20 mM, Hepes; 0.33
mM, Na2HPO4; 1.2 mM, CaCl2, pH adjusted to
7.4. For experiments in Ca2+-free medium, CaCl2 was
replaced by EGTA (2 mM). Flura-2/AM was excited with 340 nm and 380 nm laser
lines, and the emitted fluorescence at 510 nm under the Leica DMI6000 B inverted microscope (Leica, Nanterre, France)
equipped with SENSICAM EM camera for real-time recording of fluorescent images.
The changes in intracellular calcium were calculated as ?Ratio between the values of
the peak F340/F380. Results were averaged from the individual
cells (20-30 cells in a single run) with at least three independent experiments.

Live-cell
imaging of intracellular
calcium Ca2+i levels

 

Cancer cells (5 x 104 cells/well) were seeded in 96-well
culture plates in culture medium as described above in the presence or absence
of test compounds. After 48 hours, an MTT assay was used to assess cell viability
and proliferation. Culture medium was aspirated, 100 µl serum free medium and
10 µl MTT solution (5 mg/ml) were added to each well, and the plates were
incubated at 37°C for 3 hours. The medium was aspirated and 50 µl DMSO was
added to each well to dissolve the formazan crystals. After 15 min at 37°C, the
absorbance was read at 540 nm using a Spectrofluorometer SAFAS Xenius XC (MC
98000 Monaco).

Cell
viability and proliferation assays

 

Freshly
dissociated breast carcinoma cells were cultured in low-glucose Dulbecco’s
modified Eagle’s Medium supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 5000 UI/L penicillin and 100 µg/mL
streptomycin at 37°C in a humidified 5% CO2 incubator.

Primary
breast cancer cell cultures

 

Breast carcinoma specimens were obtained according to the Declaration of
Helsinki, and guidelines and protocols approved by the Institutional Review
Board of the Henri Becquerel Center (CLCC, Rouen, France). All patients signed
a written consent allowing the conservation and study of their biological
samples. Human breast specimens were obtained from 5 female donors, ages 40,
47, 50, 51 and 58, and delivered in ice-cold culture medium to the laboratory
at Rouen University within 0.5–1 hour of sampling. Clinicopathological characteristics of breast cancer
patients enrolled were reported in supplementary Table 1. Upon delivery,
tumours were rapidly minced with scissors and digested at 37 °C in humidified O2
incubator for 3 h in serum-free low-glucose Dulbecco’s modified Eagle’s Medium
containing 200 U / ml collagenase II (Sigma), 50 U / ml DNase and 5 mM CaCl2.
To obtain a single-cell suspension, cells were filtered through a 100 µm Nylon
Mesh Cell Strainer (BD Falcon, Le Pont de Claix, France) and pelleted by low-speed centrifugation.

Human
breast tumor dissociation

 

The human breast carcinoma cell lines MDA-MB-231 and MCF-7 were obtained
from the European Collection of Authenticated Cell Cultures (ECACC, Porton
Down, SP4 0JG Salisbury, UK). MDA-MB-231 cells were cultured in RPMI 1640
medium (Eurobio®, Courtaboeuf, France) containing 10% fetal bovine serum (FBS,
Eurobio®), 2 mM of L-glutamine (Eurobio®) with 5000 UI/L penicillin and 50 mg/L
streptomycin (Eurobio®). MCF-7 cells were grown
in low-glucose-DMEM medium with 10% FBS, 2 mM
L-glutamine, 5000 UI/L penicillin and 50 mg/L streptomycin. Cells were
maintained at 37°C in a 5% CO2 humidified atmosphere. The calcium
dye Fura-2/AM, 1, 2-bis (2-aminophenoxy) ethane-N,N,N,N-tetraacetic acid
(BAPTA-AM), U73122 and SKF96365 were purchased from Abcam Biochemicals (Paris,
France). Simvastatin, Poly-D-lysine, dimethylsulfoxide (DMSO),
2-APB and ethylene glycol
tetraacetic acid (EGTA) were purchased from Sigma Aldrich (St-Quentin
Fallavier, France). Doxorubicin chlorhydrate was purchased from Amersham
Pharmacia Biotech, Inc. (Uppsala, Sweden). The
rabbit polyclonal antibody against cleaved caspase-3 was purchased from Cell
Signaling Technology (Boston, MA, USA).

Cell
lines and Reagents